Questions

August 2021 2 5 Report
A dna strand has the sequence A-C-A-G-C-C-G-T-A. What would be its complementary strand​?​

Answers & Comments

Add an Answer

Please enter comments
Please enter your name.
Please enter the correct email address.
You must agree before submitting.
More Questions From This User See All
what is the difference between bourgeois and bourgeoisie
Answer
Fact or Bluff1. Cells come only from the reproduction of existing cells.2. All k...
Answer
If the DNA strand is AATCCGTACGTACGTACGTAC, what will be the complementary stran...
Answer
in long strand of dna molecule will there be an equal number of thymine
Answer
Compute the number of neutrons of an element X if the atomic number is 50 and at...
Answer
What is the relationship between chromosomes, genes, and DNA?A.) Genes are made ...
Answer
the atomic number of an atom is equal to the number of in the atoms
Answer
Four atoms have the number of protons and neutronsgiven below. Which two atoms a...
Answer
A strand of DNA has these bases: AGC CAT GTA TAC What is the complementary DNA s...
Answer
This is the practice of inserting the DNA of another species into an organism's ...
Answer

Recommend Questions

what if someone cheat on you
a complete response with a detailed explanation
ES Activity 2: TRUE OR FALSE. Write the word TRUE in the statement is correct an...
describe the events happened during the stage of menstrual cycle
while we discover how to become intuitive or strategic thinker, let us come acro...
what do you think is the contribution of sedimentary rocks and fossils to the or...
Whats meaning of netiquette...
anong paraan ang pwedeng gawin kapag ang gulay na isa sa bahay mas madaling maan...
what do you call a finger-like projection that arises from epithelial layer in s...
A body process that takes out gas from our body...

Helpful Links

Helpful Social

Copyright © 2024 EHUB.TIPS team's - All rights reserved.