Questions

August 2021 1 18 Report
DNA replication

Dna strand: GGATTAGAC
Complementary strand: ________

DNA strand: CAGAGTATA
complementary strand:
________
​​

Answers & Comments

Add an Answer

Please enter comments
Please enter your name.
Please enter the correct email address.
You must agree before submitting.
More Questions From This User See All
what is the difference between bourgeois and bourgeoisie
Answer
Fact or Bluff1. Cells come only from the reproduction of existing cells.2. All k...
Answer
If the DNA strand is AATCCGTACGTACGTACGTAC, what will be the complementary stran...
Answer
in long strand of dna molecule will there be an equal number of thymine
Answer
Compute the number of neutrons of an element X if the atomic number is 50 and at...
Answer
What is the relationship between chromosomes, genes, and DNA?A.) Genes are made ...
Answer
the atomic number of an atom is equal to the number of in the atoms
Answer
Four atoms have the number of protons and neutronsgiven below. Which two atoms a...
Answer
A strand of DNA has these bases: AGC CAT GTA TAC What is the complementary DNA s...
Answer
This is the practice of inserting the DNA of another species into an organism's ...
Answer

Recommend Questions

pasagot ngayon na ito ipapasa please
how do early beliefs about constellations effect human culture
yung tama po pls kailangan ko na bukas na talaga po submit ng modules ko
is a disease causing organism that lives in humans or other animals and derives ...
or directionbf361c2d468f8ffa07252b7f7f4e2a8d 39180
What are the possible solution that may help the preservation of our flora and f...
why are there differrence between the colling rates of sand and water
supernova elements form...
It is responsible for the extractions og energy from the food we eat...
please help me if you help me i will follow you

Helpful Links

Helpful Social

Copyright © 2024 EHUB.TIPS team's - All rights reserved.